View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6400_low_21 (Length: 218)
Name: NF6400_low_21
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6400_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 45509831 - 45509641
Alignment:
| Q |
18 |
tgatggtgacgatgatgaattttttgatgctgagcatgcaaaagatggggaggagactggtgcgtcagttgattttgttgttaatgacgacgatgatgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45509831 |
tgatggtgacgatgatgaattttttgatgctgagcatgcaaaagatggggaggagactggtgcgtcagttgattttgttgttaatgacgacgatgatgat |
45509732 |
T |
|
| Q |
118 |
gagaatgatgttcttgaaacaatggtatctgggcacaagggccggtttgattttgatgagaatgatggcaacgatgacgatgttgatgatg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45509731 |
gagaatgatgttcttgaaacaatggtatctgggcacaagggccggtttgattttgatgagaatgatggcaacgatgacgatgttgatgatg |
45509641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University