View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6400_low_7 (Length: 327)

Name: NF6400_low_7
Description: NF6400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6400_low_7
NF6400_low_7
[»] chr7 (1 HSPs)
chr7 (1-152)||(23149587-23149738)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 23149738 - 23149587
Alignment:
1 tgcacgggtataagcattcatttctcatggaaatactcttacaacattaccaattcaaaagtagagaaaatagacatataagctctacaaccaaactcta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
23149738 tgcacgggtataagcattcatttctcatggaaatactcttacaacattaccaattcaaaagtagagaaaatagatatataagctctacaaccaaactcta 23149639  T
101 aagtgatcttgagctaaaactaagatgactgggtactacgatccaccaataa 152  Q
    || |||| ||||||| ||||| |||||||||||||||| || ||||| ||||    
23149638 aattgattttgagctgaaacttagatgactgggtactaggacccacctataa 23149587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University