View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6402_low_4 (Length: 239)
Name: NF6402_low_4
Description: NF6402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6402_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 102 - 229
Target Start/End: Complemental strand, 3341573 - 3341446
Alignment:
| Q |
102 |
gaagataaacggaccgttaatctagcccgtatgacaaacaacttttagaagccagcccatatatccaaatattctaatttattttcaacttttcctcacc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3341573 |
gaagataaacggaccgttaatctagcccgtatgacaaacaacttttagaagccagcccatatatccaaatattctaatttattttcaacttttcctcacc |
3341474 |
T |
 |
| Q |
202 |
tcacttcacttctctgcccccctctctg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3341473 |
tcacttcacttctctgcccccctctctg |
3341446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 3342503 - 3342410
Alignment:
| Q |
1 |
caagaccgagcgacagttaacttccgtggagagtatttggaatggattacttcggagtggttgagagcaattttaaaagcctaaatagcaattt |
94 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342503 |
caagaccgagcgacagttaacttctgtcgagagtatttggaatggattacttcggagtggttgagagcaattttaaaagcctaaatagcaattt |
3342410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University