View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6403_high_14 (Length: 241)
Name: NF6403_high_14
Description: NF6403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6403_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 32570208 - 32570003
Alignment:
| Q |
20 |
ctgtacgcaaaaaagggtcacaagtatgaaagcataatgcatatttaatctaaatatttctttttaattggagttaatgcattagatataatacatccac |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570208 |
ctgtacacaaaaaagggtcacaagtatgaaagcataatgcatatttaatctaaatatttctttttaattggagttaatgcattagatataatacatccac |
32570109 |
T |
 |
| Q |
120 |
atagtacaagatagagaaacaaaccatgttttaggctttcaagtatcttggaaataacagctacctcaaccatgttcttcaaactgttttcgcgaccaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32570108 |
atagtacaagatagagaaacaaaccatgttttaggctttcaagtatcttggaaataacagctacctcaaccatgttcttcaaactgttttcgcgaccaaa |
32570009 |
T |
 |
| Q |
220 |
ttgttc |
225 |
Q |
| |
|
|||||| |
|
|
| T |
32570008 |
ttgttc |
32570003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 200
Target Start/End: Original strand, 32524835 - 32524865
Alignment:
| Q |
170 |
gaaataacagctacctcaaccatgttcttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32524835 |
gaaataacagctacctcaaccatgttcttca |
32524865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 200
Target Start/End: Original strand, 32531211 - 32531259
Alignment:
| Q |
152 |
aggctttcaagtatcttggaaataacagctacctcaaccatgttcttca |
200 |
Q |
| |
|
||||||| || ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
32531211 |
aggcttttaattatctcagaaataacagcaacctcaaccatgttcttca |
32531259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University