View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6403_low_17 (Length: 238)
Name: NF6403_low_17
Description: NF6403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6403_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 26846168 - 26845948
Alignment:
| Q |
18 |
ggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846168 |
ggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctc |
26846069 |
T |
 |
| Q |
118 |
cttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtggggatggggacaaaagaattatgggatttagattccaaatttaatgtagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26846068 |
cttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtggggatggggacaaaagaattatgggatttagattccaaagttaatgtagg |
26845969 |
T |
 |
| Q |
218 |
aaaggtgcaatgtgagccgat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26845968 |
aaaggtgcaatgtgagccgat |
26845948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University