View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6403_low_18 (Length: 236)
Name: NF6403_low_18
Description: NF6403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6403_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 1402759 - 1402594
Alignment:
| Q |
1 |
aaaaaccaaaaccaacggagtttgagaacaacaagggttgtacaagttaatatactaataggcaaactaggggctaatgttagtttcctaatcaacgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1402759 |
aaaaaccaaaaccaacggagtttgagaacaacaagggttgtacaagttaatatactaataggcaaactaggggctaatgttagtttcctaatcaacgtat |
1402660 |
T |
 |
| Q |
101 |
tatggtaagttgttcttctcatcatatccaagtagttatcaccgggagcatgaattggagaggaat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1402659 |
tatggtaagttgttcttctcatcatatccaagtagttatcaccgggagcatgaattggagaggaat |
1402594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 4 - 90
Target Start/End: Complemental strand, 1399061 - 1398975
Alignment:
| Q |
4 |
aaccaaaaccaacggagtttgagaacaacaagggttgtacaagttaatatactaataggcaaactaggggctaatgttagtttccta |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399061 |
aaccaaaaccaacggagtttgagaacaacaagggttgtacaagttaatatactaataggcaaactaggggctaatgttagtttccta |
1398975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 154 - 222
Target Start/End: Complemental strand, 1398947 - 1398879
Alignment:
| Q |
154 |
attggagaggaatggcgatgatgagttcgagaggaatagcattgaatgccgaggatgaaagtgttgatg |
222 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1398947 |
attggagaggaatggcgttcatgagttcgagaggaatagcgttgaatgccgaggatgaaagtgttgatg |
1398879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 1402602 - 1402562
Alignment:
| Q |
182 |
gagaggaatagcattgaatgccgaggatgaaagtgttgatg |
222 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1402602 |
gagaggaatagcgttgaatgccgaggatgaaagtgttgatg |
1402562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 820692 - 820654
Alignment:
| Q |
7 |
caaaaccaacggagtttgagaacaacaagggttgtacaa |
45 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
820692 |
caaaaccaacggagcttgagaacaacaagggttgtacaa |
820654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University