View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6404_high_9 (Length: 237)
Name: NF6404_high_9
Description: NF6404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6404_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 36171805 - 36172033
Alignment:
| Q |
1 |
ttgtaaacatgacgtttgtccacatgcttgttgctcgtgaactttttaagataagagcatagaatgatcattaatcatacatcattatataatttacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36171805 |
ttgtaaacatgacgtttgtccacatgcttgttgctcgtgaactttttaagataagagcatagaatgatcattaatcatacatcattatataatttacatt |
36171904 |
T |
 |
| Q |
101 |
acccttatgtttgttttctctggnnnnnnnaagtactttgcttaaaataatttgcggcgtgaattgtggaagtacaagttcctaaatatgggaaatcaat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36171905 |
acccttatgtttgttttctctggtttttttaagtactttgcttaaaataatttgcggcgtgaattgtggaagtacaagttcctaaatatgggaaatcaat |
36172004 |
T |
 |
| Q |
201 |
tttcttgattgtgtgagtgtgatgatgtc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36172005 |
tttcttgattgtgtgagtgtgatgatgtc |
36172033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University