View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6404_low_7 (Length: 238)
Name: NF6404_low_7
Description: NF6404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6404_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 224
Target Start/End: Complemental strand, 497010 - 496897
Alignment:
| Q |
110 |
taaagttgtgttttaccacaaagtagtgtaaaccgattggaaaatatccaaatcatacatgttctagatttaagatgtaaagatacaaaaacacaacatc |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
497010 |
taaagttatgttttaccacaaagtagtgtaaaccgattggaaaatatccaaatcatacatgttctagatttaagatgt-aagatacaaaaacacaacatc |
496912 |
T |
|
| Q |
210 |
aaatatgtgtgtatt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
496911 |
aaatatgtgtgtatt |
496897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 29458392 - 29458360
Alignment:
| Q |
16 |
attacattcgatctcttccattttctcaaatta |
48 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
29458392 |
attacattcaatctcttccattttctcaaatta |
29458360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University