View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6406_low_3 (Length: 320)
Name: NF6406_low_3
Description: NF6406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6406_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 141 - 248
Target Start/End: Complemental strand, 1755878 - 1755771
Alignment:
| Q |
141 |
ccatctcatgtcattgtgataggcaaatttataggaatctgttttagtttaggatctaaaatttcaccatcatcataaatatcacttaaatctgttttct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1755878 |
ccatctcatgtcattgtgataggcaaatttataggaatctgttttagtttaggatctaaaatttcaccatcatcataaatatcacttaaatctgttttct |
1755779 |
T |
|
| Q |
241 |
tttatttt |
248 |
Q |
| |
|
|||||||| |
|
|
| T |
1755778 |
tttatttt |
1755771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 255 - 320
Target Start/End: Complemental strand, 1755791 - 1755725
Alignment:
| Q |
255 |
aaatctgttttctat-attttttgaatagcatatctattactacatcgtttaatctctccaaccaac |
320 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1755791 |
aaatctgttttcttttattttttgaatagcatatctattactacatcgtttaatctctccaaccaac |
1755725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 62
Target Start/End: Complemental strand, 1756006 - 1755957
Alignment:
| Q |
13 |
aagtcaaaactaatcctaatccaaatttgaattacagatatagtaaaacc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1756006 |
aagtcaaaactaatcctaatccaaatttgaattacagatatagtaaaacc |
1755957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University