View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6406_low_4 (Length: 263)
Name: NF6406_low_4
Description: NF6406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6406_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 248
Target Start/End: Original strand, 52851735 - 52851969
Alignment:
| Q |
13 |
cacagacacagataaaccatgaagtaaaagaacaaaaattacaaaaagatataactatggcattcatctcacagaaaggaagctgtttggatcgatattg |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52851735 |
cacaaacacagataaaccatgaagtaaaagaacaaaaattacaaaaagatataactatggcattcatctcacagaaaggaagctgtt-ggatcgatattg |
52851833 |
T |
 |
| Q |
113 |
ttgccacaccatccatgataaaatacgcttgagcaaattcaaaataataatgaaaatacataaatcatatgatacatatgacacatcacttgctgacttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851834 |
ttgccacaccatccatgataaaatacgcttgagcaaattcaaaataataatgaaaatacataaatcatatgatacatatgacacatcacttgctgacttt |
52851933 |
T |
 |
| Q |
213 |
ggttgctaatttattttcataaccctttctttattt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851934 |
ggttgctaatttattttcataaccctttctttattt |
52851969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University