View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6407_low_1 (Length: 627)
Name: NF6407_low_1
Description: NF6407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6407_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 435; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 17 - 463
Target Start/End: Original strand, 40439289 - 40439735
Alignment:
| Q |
17 |
ataaggaagaagctctttaacaacatcaaaacgacctttctcagcagcggtaaaaagcgcggtttcacccaagtcattaacttcattaacaatggcagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439289 |
ataaggaagaagctctttaacaacatcaaaacgacctttctcagcagcggtaaaaagcgcggtttcacccaagtcattaacttcattaacaatggcagac |
40439388 |
T |
 |
| Q |
117 |
cttatatccgcaacttcagcatcaaactcagcaccactaagcgttcccatcatttgatcatcaatctcagccagaatattcctaacagcagcagcatcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439389 |
cttatatccgcaacttcagcatcaaactcagcaccactaagcgttcccatcatttgatcatcaatctcagccagaatattcctaacagcagcagcatcac |
40439488 |
T |
 |
| Q |
217 |
cgcgttgcgcggcaagatgaagctcggtgtcattatgacgaccggtgacctgtttaacatattttttcttgctgggtgtctcgacgaggcgtttgccgga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40439489 |
cgcgttgcgcggcaagatgaagctcggtgtcattatgacgaccggtgacctgtttaacatattttttcttgcagggtgtctcgacgaggcgtttgccgga |
40439588 |
T |
 |
| Q |
317 |
attggaaatgacgagggatttgttggagtttgagacaagaagggctttgccggaagtggagaggaatagggtgggtcttggggtggttggagtgttgggt |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40439589 |
attggaaatgacgagggatttgttggagtttgagacaagaagggctttgcccgaagtggagaggaatagggtgggtcttggggtggttggggtgttgggt |
40439688 |
T |
 |
| Q |
417 |
tcagaaagaggagcgtggccgccggggtgatccatgaatggccgtcg |
463 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40439689 |
tcagaaagaggagcgtggccgccggggtgatccatgaatggccgtcg |
40439735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 522 - 621
Target Start/End: Original strand, 40439794 - 40439893
Alignment:
| Q |
522 |
tgccccattcctcaacccttcaatccctcctctgtttttgttgatctgcaccattggcggaaaaactccaaacaaatatcgttgctttctctgctcctcc |
621 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40439794 |
tgccccattcctcaacccttcaatccctcctctgtttttgttgatctgcaccattggcggaataactccaaacaaatatcgttgctttctttggtcctcc |
40439893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University