View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6408_low_2 (Length: 279)
Name: NF6408_low_2
Description: NF6408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6408_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 25273484 - 25273224
Alignment:
| Q |
11 |
caaaggtggtgggatggtggaagtgtttgtcagcggttagtttaaagttaaaacgacgacggtgtggagagcgaggtcgccagagtggatagcaagagag |
110 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25273484 |
caaaggtgatgggatggtggaagtgtttgtcagcggtaagtttaaagttaaaacgacgatggcgtggagagcgaggtcgccagagtggatagcaagagag |
25273385 |
T |
|
| Q |
111 |
aatgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttannnnnnnatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25273384 |
aatgatttgctaatggtggaagttgcgatgttggatcagtgtgtggttgcagtgatgctgtagctagctcctacttcttctcctatcttatttttttatg |
25273285 |
T |
|
| Q |
211 |
atttcctttctctctcaaacaaatatttcatatggcctttgtttttgttttgatgatgatg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25273284 |
atttcctttctctctcaaacaaatatttcatatggcatttgtttttgttttgatgatgatg |
25273224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University