View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6408_low_3 (Length: 268)
Name: NF6408_low_3
Description: NF6408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6408_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 21611782 - 21612032
Alignment:
| Q |
7 |
ttttacgtcattcacattttcatgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagaggagaacttgttatagactcttctaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611782 |
ttttacgtcattcacattttcatgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagaggagaacttgttatagactcttctaaga |
21611881 |
T |
|
| Q |
107 |
tagcatcaaggtacttgcataagggtttcttcttggactttattgctgccctgccccttcctcaggcaagttaatgaagagcgaggttttaactttttaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611882 |
tagcatcaaggtacttgcataagggtttcttcttggactttattgctgccctgccccttcctcaggcaagttaatgaagagcgaggttttaactttttaa |
21611981 |
T |
|
| Q |
207 |
cctataatcgacgtcttgtcgcaatctttgacaatgctgctcttttttcat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21611982 |
cctataatcgacgtcttgtcgcaatctttgacaatgctgctcttttttcat |
21612032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 40513459 - 40513397
Alignment:
| Q |
28 |
atgaggtttcatacggcatatgttgcaccttcttctagggtttttgggagaggagaacttgtt |
90 |
Q |
| |
|
|||| ||||| ||| || |||||||| |||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
40513459 |
atgaagtttcgtacagcttatgttgctccttcttccaaggtttttggtagaggagaacttgtt |
40513397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 90
Target Start/End: Complemental strand, 40482767 - 40482723
Alignment:
| Q |
46 |
tatgttgcaccttcttctagggtttttgggagaggagaacttgtt |
90 |
Q |
| |
|
|||||||| |||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
40482767 |
tatgttgctccttcttccaaggtttttggtagaggagaacttgtt |
40482723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University