View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6408_low_5 (Length: 234)
Name: NF6408_low_5
Description: NF6408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6408_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 42292806 - 42292882
Alignment:
| Q |
1 |
atggaaggtttgctctataatgcacttgttgatgtcgtttttacagggcatgttcatgcctacgaacgctttgtaag |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42292806 |
atggaaggtttgctctataatgcacttgttgatgtcgtttttacagggcatgttcatgcatacgaacgctttgtaag |
42292882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 196
Target Start/End: Original strand, 42292911 - 42292943
Alignment:
| Q |
164 |
tctagttgaagtactggttcaatcgggttgaaa |
196 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42292911 |
tctagttgaagtgctggttcaatcgggttgaaa |
42292943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University