View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6409_high_19 (Length: 281)

Name: NF6409_high_19
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6409_high_19
NF6409_high_19
[»] chr2 (1 HSPs)
chr2 (209-248)||(33413253-33413292)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 248
Target Start/End: Original strand, 33413253 - 33413292
Alignment:
209 ttatttagttgagtgtttgtgagcaattgcatgtaacact 248  Q
    ||||||||||||||||||||||||||||||||||||||||    
33413253 ttatttagttgagtgtttgtgagcaattgcatgtaacact 33413292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University