View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6409_high_32 (Length: 239)

Name: NF6409_high_32
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6409_high_32
NF6409_high_32
[»] chr8 (1 HSPs)
chr8 (1-224)||(30242753-30242976)


Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 30242753 - 30242976
Alignment:
1 tagtttgttgcgaggtggatggttgtattcaaggattcgagatttgggtttggaaaagcttagacgggtaagggtttttgctcttgagggatgtttaggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30242753 tagtttgttgcgaggtggatggttgtattcaaggattcgagatttgggtttggaaaagcttagacgggtaagggtttttgctcttgagggatgtttaggc 30242852  T
101 ttctcttgataaggttcagtgtagtggtgagtttcagtgtccatagtagaaggtttagggttgggttgttggtcaaggaagagaacaacttgaggttcgg 200  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30242853 ttctcttgatgaggttcagtgtagtggtgagtttcagtgtccatagtagaaggtttagggttgggttgttggtcaaggaagagaacaacttgaggttcgg 30242952  T
201 attcagcagtgtccattttagttg 224  Q
    ||||||||||||||||||||||||    
30242953 attcagcagtgtccattttagttg 30242976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University