View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_high_37 (Length: 217)
Name: NF6409_high_37
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 39741488 - 39741303
Alignment:
| Q |
18 |
atactaacttgaacgttaaaaatgtttatagatacatttacattatacgtatcaatgatgtggatttcgaccaaacaccactattcaagaatgagttcca |
117 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39741488 |
atactaacttgaatgttaaaa-tgtttatagatacatttacattatacgtatcaatgatgtggacttcgaccaaacaccactattcaagaatgagttcca |
39741390 |
T |
 |
| Q |
118 |
aatcattctagaagtgtccgtgattgtatttttgctataattagcatttctctatgattagatggcccttgttttgaggcttgaagt |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39741389 |
aatcattctagaagtgtctgtgattgtatttttgctataattagcatttctctatgattagatgtcccttgttttgaggcttgaagt |
39741303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University