View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_27 (Length: 248)
Name: NF6409_low_27
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 43961329 - 43961099
Alignment:
| Q |
1 |
aaagttgctaccatccacctgagtcggatgaaaaataatactaagtactacattgttttctgttnnnnnnncaagtgtcttgatcatgtagttgacattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43961329 |
aaagttgctaccatccacctgagtcggatgaaaaataatactaagtactacattgttttctgttaaaaaaacaagtgtcttgatcatgtagttgacattc |
43961230 |
T |
 |
| Q |
101 |
aattaacgttgtaagagaaagagagattacggagt-nnnnnnntgtttgcgaaaggggggaccatcgattaagagagcgcaaagaagagtagtaagcatg |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961229 |
aattaacgttgtaagag--agagagattacggagtaaaaaaaatgtttgcgaaaggggggaccatcgattaagagagcgcaaagaagagtagtaagcatg |
43961132 |
T |
 |
| Q |
200 |
agagctccataagcaccaaacagaggtctcaaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43961131 |
agagctccataagcaccaaacagaggtctcaaa |
43961099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University