View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_32 (Length: 241)
Name: NF6409_low_32
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 101 - 231
Target Start/End: Original strand, 36458776 - 36458899
Alignment:
| Q |
101 |
tataaaacaaaagctgttttaatatctctccataaaatggcgttcaaacatgcattaaatgaaagctacaatatgcagctatcggtgaacagtgaacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36458776 |
tataaaacaaaagctgttttaatatctctccataaaatggcgttcaaacatgcattgaatgaaagctacaatatgcagctatcg-------gtgaacttg |
36458868 |
T |
|
| Q |
201 |
tctaagattgtttttcttcttcccgttcatc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36458869 |
tctaagattgtttttcttcttcccgttcatc |
36458899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 17 - 102
Target Start/End: Original strand, 36458656 - 36458741
Alignment:
| Q |
17 |
tgcttgggaagaataagattgctattaagagcttagatagaagagaagatgcaagcacatgaccacgcatgacaccttagttaata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458656 |
tgcttgggaagaataagattgctattaagagcttagatagaagagaagatgcaagcacatgaccacgcatgacaccttagttaata |
36458741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University