View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_36 (Length: 238)
Name: NF6409_low_36
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 41574755 - 41574554
Alignment:
| Q |
1 |
tgtttaaagtttactgacctttactcatattttgccatatgaacataacataaacatatttctaagaattaatattatgacgtgctaagattttaaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574755 |
tgtttaaagtttactgacctttactcatattttgccatatgaacataacataaacatatttctaagaattaatattatgacgtgctaagattttaaaatg |
41574656 |
T |
|
| Q |
101 |
tggttcgnnnnnnnnnnagagaaaaggtagtggtcataataataaaatgcactcactatttcactccaaatatttgttgaatctttagagaaaaggtagt |
200 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41574655 |
tggttcg-tttttttttagagaaaaggtagt-gtcataataa------------------tcactccaaatatttgttgaatctttagagaaaaggtagt |
41574576 |
T |
|
| Q |
201 |
ggtccaagccaacaaaacaaac |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41574575 |
ggtccaagccaacaaaacaaac |
41574554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University