View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_44 (Length: 211)
Name: NF6409_low_44
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 199
Target Start/End: Complemental strand, 27888336 - 27888150
Alignment:
| Q |
16 |
cacctttaacaaatattatttgcaataaatggtgcctcttaaagtcnnnnnnnnncacatagagattgttgaatgggaaaattacgac---taaagacaa |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27888336 |
cacctttaacaaatatcatttgcaataaatggtgcctcttaaaagtcttttttttcacatagagattgttgaatgggaaaattacgacgactaaagacaa |
27888237 |
T |
|
| Q |
113 |
tgtgatttgtcgtggagtttttcttataggctcgttggtatatccaagtggatatgggaaggagaagagtatcatcatatattcttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27888236 |
tgtgatttgtcgtggagtttttcttataggtccgttggtatatccaagtggatatgggaaggagaagagtatcatcacatattcttg |
27888150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University