View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_45 (Length: 209)
Name: NF6409_low_45
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 17 - 166
Target Start/End: Complemental strand, 53236325 - 53236176
Alignment:
| Q |
17 |
attctgagctcaagaaaacaatagccgcttgctttcctggtggctatcccaccgaaccaaactccgaacctcaaaagtcttctcctnnnnnnnctgtcga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
53236325 |
attctgagctcaagaaaacaatagccgcttgctttcctggtggctaccccaccgaaccaaactccgaacctcaaaagccttctcctaaaaaaactgtcga |
53236226 |
T |
 |
| Q |
117 |
tacctttggacaacgcacctccatctatcgcggtgtcacgaggtatgttt |
166 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53236225 |
taccttcggacaacgcacctccatctatcgcggtgtcacgaggtatgttt |
53236176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University