View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6409_low_46 (Length: 206)
Name: NF6409_low_46
Description: NF6409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6409_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 1462778 - 1462955
Alignment:
| Q |
18 |
actcaatccctttaatttaccatcacacaattctactatactatttttggtgcttttaaattcacaaaccaatatatgttaatatgaatgaataggtaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1462778 |
actcaatccctttaatttaccatcacacaattctactatactatttttggtgcttttaaattcacaaaccaatatatgttaatatgaatgaataggtaca |
1462877 |
T |
|
| Q |
118 |
tatatatcatggtctggctctcaacaatactatacttggtattggttttcttccctacactacagacaacatctgatg |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1462878 |
tatatatcatgctctggctctcaacaatactatacttggtattggttttcttccctacactacagacaacaactgatg |
1462955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 105 - 190
Target Start/End: Complemental strand, 1430205 - 1430120
Alignment:
| Q |
105 |
atgaataggtacatatatatcatggtctggctctcaacaatactatacttggtattggttttcttccctacactacagacaacatc |
190 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||| ||||||||||||| |||||||||| ||| |||||||||| |
|
|
| T |
1430205 |
atgaataggtacataaattacatggcagtgctctcaacaatactatgcttggtattggttatcttccctaccctaaagacaacatc |
1430120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University