View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6410_high_15 (Length: 240)
Name: NF6410_high_15
Description: NF6410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6410_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 94 - 233
Target Start/End: Original strand, 45213085 - 45213224
Alignment:
| Q |
94 |
gttaataatcttatggaatttgtgctcgcatgctatgagatcaatgttgatgttgagctattgatatgaaaacttcatgtaagaaatcttgtggacttcg |
193 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45213085 |
gttaatattcttatgcaatttgtgctcgcatgctatgagatcaatgttgatgttgagctattgatatgaaaacttcatgtaagaaatcttgtggacttcg |
45213184 |
T |
|
| Q |
194 |
accccacatttttccacttaattatattgatgatgatgat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45213185 |
accccacatttttccacttaattatattgatgatgatgat |
45213224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 80
Target Start/End: Original strand, 45213006 - 45213061
Alignment:
| Q |
25 |
cagatattaatcacctctcaacgatgataaaaacttcttatcgatattatcctaac |
80 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45213006 |
cagatattagtcacctctcaacgatgataaaaactttttatcgatattatcctaac |
45213061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University