View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6410_high_7 (Length: 391)
Name: NF6410_high_7
Description: NF6410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6410_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 376
Target Start/End: Complemental strand, 4395952 - 4395595
Alignment:
| Q |
18 |
ggagagacgagccaaagctcgagggaaccgtcttcgcgagcagcggcaacacgtaagccgtcgacgctggtggctagtgcaatgacaggtgatggtttcc |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395952 |
ggagagacgagccagagctcgagggaaccgtcttcgcgagcagcggcaacacgtaagccgtcgacgctggtggctagtgcaatgacaggtgatggtttcc |
4395853 |
T |
|
| Q |
118 |
aatcaatttgtaaaccgtcgaccttcgtgaatgaaggtttttgattatggtgtagttgaaccatgtttgtgggtagg--ttagagtttgattctagcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4395852 |
aatcaatttgtaaaccgtcgaccttcgtgaatgaagctttttgattatggtgtagttgaaccatgtttgtgggtaggtattagagtttgattctagcttc |
4395753 |
T |
|
| Q |
216 |
gcggcggtgtgtggcttgaatcgccggaggagatgggtgcttgctttgagagaaatcaaaagggtagtacgtacacattcaaaatgggctacatagtttt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||| ||||||||| ||||| |||| |
|
|
| T |
4395752 |
gcggcggtgtgtggcttgaatcgccggaggagatcggtgcttgctttgagagaaatcaaaa---tattacgtacacatttaaaatgggcgacatattttt |
4395656 |
T |
|
| Q |
316 |
cttttatgatttagggtttagtaaaaccttaaccaaatcacgtgtgtaagaacgatcacag |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4395655 |
cttttatgatttagggtttagtaaaaccttaaccaaatcacgtgtttaagaacgatcacag |
4395595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University