View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6411_high_6 (Length: 236)
Name: NF6411_high_6
Description: NF6411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6411_high_6 |
 |  |
|
| [»] scaffold0564 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0564 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0564
Description:
Target: scaffold0564; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5801 - 6040
Alignment:
| Q |
1 |
acattttatctcaaaagcttaaatacaattttatacatgcttgtttatttatagttattatttgaagatgttttcaaagtagagtatacagtgatttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5801 |
acattttatctcaaaagcttaaatacaattttatacatgcttgtttatttatagttattatttgaagatgttttcaaagtagagtatacagtgatttgtt |
5900 |
T |
 |
| Q |
101 |
tcacttttctactacattgttatagatg-ttttaggctgcatcttaatctt------------------aagagatatgtaactattctaattgtgagct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5901 |
tcacttttctactacattgttatagatgtttttaggctgcatcttaatcttggcattttctgaataatatagaaatatgtaactattctaattgtgagct |
6000 |
T |
 |
| Q |
182 |
ctctttgaatttagaggccacatgtttagaatattaattg |
221 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6001 |
ctctttgaacttagaggccacatgtttagaatattaattg |
6040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University