View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6411_high_8 (Length: 204)
Name: NF6411_high_8
Description: NF6411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6411_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 39124469 - 39124275
Alignment:
| Q |
1 |
catatccctatggagcacattcatttgccaaacgtttcaaa-ttttcaacaaataaataacaaacaaaaaatagtgacctactgattgattgcatctaga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39124469 |
catatccctatggagcacattcatttgccaaacgtttcaaaattttcaacaaataaataacaaacaaaaaatagtgacctactgattgattgcatctaga |
39124370 |
T |
 |
| Q |
100 |
atctaaagtatgcacctaaaagagtcagccatccaactatacaatccgctctcaccaaatagtttaatagatctgcaggaacatgtatatgatga |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39124369 |
atctaaagtatgcacctaaaagagtcagccatccaactatacaatccgctctcaccaaatagtttaatagatctgcaggaacatgtacatgatga |
39124275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University