View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6411_low_4 (Length: 250)
Name: NF6411_low_4
Description: NF6411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6411_low_4 |
 | |
|
| [»] scaffold0564 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0564 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0564
Description:
Target: scaffold0564; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 5721 - 5479
Alignment:
| Q |
1 |
aattcatagaatatatattttaaagagagattttagcaatttttcattgttnnnnnnnccagtgttaaaaatatactattaaccacctactaaatgttat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5721 |
aattcagagaatatatattttaaagagagattttagcaatttttcattgttaaaaaaaccagtgttaaaaatatactattaaccacctactaaatgttat |
5622 |
T |
|
| Q |
101 |
taatcacatataaactgtattaaacatgtagtaagagttttttctacattacctcttaacgaattgaaggtaatttacccatatcaaataaaaataacnn |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5621 |
taatcccatataaactgtattaaacatgtagtaagagttttttctacattacctcttaacgaattgaaggtaatttacccatatcaaataaaaataactt |
5522 |
T |
|
| Q |
201 |
nnnnnncatctttatccttacaatcagttacaattttcatctc |
243 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
5521 |
tttcttcatctttatccttaaaatcaggtacaattttcatctc |
5479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University