View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6411_low_6 (Length: 248)
Name: NF6411_low_6
Description: NF6411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6411_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 166
Target Start/End: Complemental strand, 6129968 - 6129808
Alignment:
| Q |
8 |
aaaaagacaaaaacaatttcaaatttggtgtgtacaactttttcaatatacccttgagacaattttcagtaaaataaccaatcaaactcacac--attaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6129968 |
aaaaagacaaaaacaatttcaaatttggtgtgtacaactttttcaatatacccttgagacaattttcagtaaaataaccaatcaaactcacacatattaa |
6129869 |
T |
|
| Q |
106 |
aactttcaaaattatagcaaatagaaaaatacacacaacaacaatataatacagtcttgtc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
6129868 |
aactttcaaaattatagcaaatagaaaaatacacgcaacaacaacataatacagtcttgtc |
6129808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 181 - 219
Target Start/End: Complemental strand, 6129788 - 6129750
Alignment:
| Q |
181 |
taatacagtcttttccctaatatggtaaagctatttttt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6129788 |
taatacagtcttttccctaatatggtaaagctatttttt |
6129750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University