View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6412_high_6 (Length: 330)
Name: NF6412_high_6
Description: NF6412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6412_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 309
Target Start/End: Original strand, 10559536 - 10559831
Alignment:
| Q |
13 |
aatatagggcacttgtgtatggatgcaaaatcaaattgcaaagaaaaaagtggtgcatgagcgattgcaagtatcacaacaacaaactaggatgagtcaa |
112 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10559536 |
aatatagggcacttgcgtatggatgcaaaatcaaattgcaaaaaaaaaagtggtgcatgagcgattgcaagtatgacaacaacaaactaggatgagtcaa |
10559635 |
T |
 |
| Q |
113 |
aatgaatctaatatttgaaatttggcgtgtgaacgcgatcgccaacacgaaaaacggatccattcacttcaaaccgagcacgacgaaagtgacaacaaca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
10559636 |
aatgaatctaatatttgaaatttggcgtgtgaacgcgatcgccaacacg-aaaacggatccattcaccacaaaccgagcacgacgaaagtgaaaacaaca |
10559734 |
T |
 |
| Q |
213 |
agcataaacgactatgaggcaacctgagatgcagaagagcatccagttcgtgaagccttggctcttttgagcaataaaaaccagagacaaaaccttc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10559735 |
agcataaacgactatgaggcaacctgagatgcagaagaacatcaagctcgtgaagccttggctcttttgagcaataaaaaccagaggcaaaaccttc |
10559831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University