View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6413_low_17 (Length: 265)
Name: NF6413_low_17
Description: NF6413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6413_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38117213 - 38117026
Alignment:
| Q |
1 |
caaatattcaaattgttgcctttcttggctacataaaaattgaatgaatgtaaacatgtctcacacttgtaaatttatttttagactttgtttcatcaaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38117213 |
caaatattcaagttgttgcctttcttggcaacataaaaattgaatgaatgtaaacatgtctcacacttgtaaatttatttttagactttgtttcatcaaa |
38117114 |
T |
 |
| Q |
101 |
tacaaactcttaacaagtttaattgtgcacggtgtgaaatcattgccaaagtagggaaacaatttaaattttttatctcatgtgtaag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38117113 |
tacaaactcttaacaagtttaattgtgcacggtgtgaaatcattggcaaagtagggaaacaatttaatttttttatctcatgtgtaag |
38117026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 265
Target Start/End: Complemental strand, 38116994 - 38116957
Alignment:
| Q |
228 |
attggtccgttgttgctctcgaatttcccacaccccaa |
265 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38116994 |
attggtccgttgttgctctcgactttcccacaccccaa |
38116957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University