View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6413_low_17 (Length: 265)

Name: NF6413_low_17
Description: NF6413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6413_low_17
NF6413_low_17
[»] chr7 (2 HSPs)
chr7 (1-188)||(38117026-38117213)
chr7 (228-265)||(38116957-38116994)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38117213 - 38117026
Alignment:
1 caaatattcaaattgttgcctttcttggctacataaaaattgaatgaatgtaaacatgtctcacacttgtaaatttatttttagactttgtttcatcaaa 100  Q
    ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38117213 caaatattcaagttgttgcctttcttggcaacataaaaattgaatgaatgtaaacatgtctcacacttgtaaatttatttttagactttgtttcatcaaa 38117114  T
101 tacaaactcttaacaagtttaattgtgcacggtgtgaaatcattgccaaagtagggaaacaatttaaattttttatctcatgtgtaag 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||    
38117113 tacaaactcttaacaagtttaattgtgcacggtgtgaaatcattggcaaagtagggaaacaatttaatttttttatctcatgtgtaag 38117026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 265
Target Start/End: Complemental strand, 38116994 - 38116957
Alignment:
228 attggtccgttgttgctctcgaatttcccacaccccaa 265  Q
    |||||||||||||||||||||| |||||||||||||||    
38116994 attggtccgttgttgctctcgactttcccacaccccaa 38116957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University