View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6413_low_18 (Length: 260)
Name: NF6413_low_18
Description: NF6413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6413_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 251
Target Start/End: Complemental strand, 6631909 - 6631646
Alignment:
| Q |
2 |
atcaaaatggggcaaagaatttactaaggaaggaggaatttactcataacacaatcttagagagtactggtaacatgacaaatatgaaatctaaccttgt |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631909 |
atcaaaatggggcagagaatttactaaggaaggaggaatttactcataacacaatcttagagagtactggtaacatgacaaatatgaaatctaaccttgt |
6631810 |
T |
 |
| Q |
102 |
tgatttgagtacatgtaacccttttttgggtcctgttaatgggaagaaggcatc--------------cctcttccttagctcagggtagtttaattgag |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6631809 |
tgatttgagtacatgtaacccttttttgggtcctgttaatgggaagaaggcatccctcattacaggtccctcttccttagcttagggtagtttaattgag |
6631710 |
T |
 |
| Q |
188 |
agtgcactccccactactattcctgagtctattgtttttgttgaagttccctttgttgatgatg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631709 |
agtgcactccccactactattcctgagtctattgtttttgttgaagttccctttgttgatgatg |
6631646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 7906533 - 7906393
Alignment:
| Q |
19 |
aatttactaaggaaggaggaatttactcataacacaatcttagagagtactggtaacatgacaaatatgaaatctaaccttgttgatttgagtacatgta |
118 |
Q |
| |
|
|||| ||||||||||||||| || | ||| ||||||| |||||| |||||||||||| || ||| | ||| |||||| |||||| ||||||| || ||| |
|
|
| T |
7906533 |
aattcactaaggaaggaggacttgaatcacaacacaaacttagatagtactggtaacttggtaaaaaggaactctaactttgttgctttgagttcaagta |
7906434 |
T |
 |
| Q |
119 |
acccttttttgggtcctgttaatgggaagaaggcatccctc |
159 |
Q |
| |
|
||||| | ||||| || || ||||||||||||||||||||| |
|
|
| T |
7906433 |
accctctattgggcccggtcaatgggaagaaggcatccctc |
7906393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University