View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6413_low_25 (Length: 236)
Name: NF6413_low_25
Description: NF6413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6413_low_25 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 19348 - 19575
Alignment:
| Q |
1 |
ctcagaaatgttcttgttgtggaaaaccattgaaagttaagtcttcttctccctatattgccaaagcgagacactcggaagcacgagccccgactccttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19348 |
ctcagaaatgttcttgttgtggaaaaccattgaaagttaagtcttcttctccctatattgccaaagcgagacactcggaagcacgagccccgactccttc |
19447 |
T |
 |
| Q |
101 |
accacgagctttcccattttcatcatcaaaaaacgatcatcctcattctcttgatttgcctcacattggctatacaccactcaagtttatgtcaccaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19448 |
accacgagctttcccattttcatcatcaaaaaacgatcatcctcattctcttgatttgcctcacattgggtatacaccactcaagtttatgtcaccaaat |
19547 |
T |
 |
| Q |
201 |
gactctgagcatctagaggatgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
19548 |
gactctgagcatctagaggaggatgatg |
19575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University