View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6413_low_30 (Length: 226)
Name: NF6413_low_30
Description: NF6413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6413_low_30 |
 | |
|
| [»] scaffold0103 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 22411909 - 22412129
Alignment:
| Q |
12 |
catcatcaatgccatgttttccgcattatcagagaggtggtgtaagaagacctacaacttccatcttcatgttggggagatgaatgcagttgctccttta |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22411909 |
catcatcagtgccatgttttccgcattatcagagaggtggcgtaagaagaccaacaacttccatcttcatgttggggagatgaatgtagttgctccttta |
22412008 |
T |
|
| Q |
112 |
gtttattagtttaagttttg------------aggttgatgttttgttcttgattaattgcttagtaagaatattgttaagcaacctagttagtttatat |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22412009 |
gtttattagtttaagttttgatgatgtttgttaggttgatgttttgttcttgattaattgcttagtaagaatattgttaagcaccctagttagtttatat |
22412108 |
T |
|
| Q |
200 |
ctcaaacattatgatgatgtc |
220 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
22412109 |
ctcaaatattatgatgatgtc |
22412129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 94
Target Start/End: Original strand, 14388 - 14438
Alignment:
| Q |
44 |
agaggtggtgtaagaagacctacaacttccatcttcatgttggggagatga |
94 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
14388 |
agaggtggcataaggagaccaacaacttccatctacatgttggggagatga |
14438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University