View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6414_low_2 (Length: 385)
Name: NF6414_low_2
Description: NF6414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6414_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 7e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 3619651 - 3619832
Alignment:
| Q |
11 |
cacagatatgacggaaattgctaacaatgacataaacataaggatggggtgggacagtcaaaatgattcgtaatctggcatggttatcctgttacaatcg |
110 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
3619651 |
cacagagacgacggaaactgctaacaatgacataaacataaggatggggtgggatggtcaaaatgattcgtaatctggcatggttaacctgttacactcg |
3619750 |
T |
 |
| Q |
111 |
gtctttttgttgatattgttcagattatataatctgtctctgaattgttggcacaaaaagagtgtatggtgctcgaattttttaat |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||| | | ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3619751 |
gtctttttgttgatattgttcaaattatgt----ttcctctgaattgttggcacaaaaagagtgtatggtgctcaaattttttaat |
3619832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University