View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6415_low_5 (Length: 270)
Name: NF6415_low_5
Description: NF6415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6415_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 259
Target Start/End: Original strand, 36679918 - 36680159
Alignment:
| Q |
18 |
agataggacctcttttgaggatagaaaccatgtttttgactctgtctgagttttcaggatgtttttccaatatgtctaagaaaccggggtcaattcctga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36679918 |
agataggacctcttttgaggatagaaaccatgtttttgactctgtctgagttttcaggatgtttttccaatatgtctaagaaaccggggtcaattcctgt |
36680017 |
T |
|
| Q |
118 |
gtcaaaaactccattgccggtatcgtgtttgagcattccttcatgccagaaaacgtcgattttgttcacactggaagattctgctgccgcatctctattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36680018 |
gtcaaaaactccattgccggtatcgtgtttgagcattccttcatgccagaaaacttcgattttgttcacactggaagattctgctgccgcatctctattc |
36680117 |
T |
|
| Q |
218 |
gttgccatttgaatgaagggagggttggtcggtcacaggttc |
259 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
36680118 |
gttgccatttgaatcaagagagggttggtcggtcactggttc |
36680159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University