View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6415_low_7 (Length: 251)

Name: NF6415_low_7
Description: NF6415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6415_low_7
NF6415_low_7
[»] chr7 (1 HSPs)
chr7 (11-251)||(12022058-12022298)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 12022298 - 12022058
Alignment:
11 cacagagggaaaatcaagttcattttctggatgcaacagtacacacaaaaccaaaacaatgtggttcttcttccatgcaacactatatcatttgatagaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12022298 cacagagggaaaatcaagttcattttctggatgcaacagtacacacaaaaccaaaacaatgtggttcttcttccatgcaacactatatcatttgatagaa 12022199  T
111 attaatatgaacttatatccaaccaacctgtagtgtggcggtgacattgtacctgggaagcttcctgtaatcaaatatcagagtgagttttttgtttgaa 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||    
12022198 attaatatgaacttatatccaaccaacctgtagtgtggcggtgacattgtacctgggaagcttcctgtaatcaaatatcgaggtgagttttttgtttgaa 12022099  T
211 atttaatttattggagacacgtatatgaaatgaattggaaa 251  Q
    |||||||||||||||||||||||||||||||||||||||||    
12022098 atttaatttattggagacacgtatatgaaatgaattggaaa 12022058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University