View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6416_low_13 (Length: 210)
Name: NF6416_low_13
Description: NF6416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6416_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 32219328 - 32219514
Alignment:
| Q |
1 |
agacactatgggcagtttggaaatttcaaacttaaagcagagggcaattttgtaaaaacacaacaccatatctccttcctctcttctctgtgtg-ttgtt |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| || || |
|
|
| T |
32219328 |
agacattatgggcagtttggaaatttcaaacttaaagcagagggtaattttgtaaaaacacaacaccctatctccttcctctcttctctgtgtgtttttt |
32219427 |
T |
 |
| Q |
100 |
tctttctctattcttccaccatgctttgtgtcttcaccgccgtagccctcttccaccaccgccataatcgccaccgcaccctccgcc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32219428 |
tctttctctattcttccaccatgctttgtgtcctcaccgtcgtagccctctcccaccaccgccataatcgccaccgcaccctccgcc |
32219514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 93 - 197
Target Start/End: Original strand, 20067720 - 20067822
Alignment:
| Q |
93 |
tgttgtttctttctctattcttccaccatgctttgtgtcttcaccgccgtagccctcttccaccaccgccataatcgccaccgcaccctccgccttcatt |
192 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||| | ||||| ||| ||| || |||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
20067720 |
tgttttttctctctctattcttccaccatgctttgt--cctcaccaccgcctcccactcccaccaccaccataatcgccaccacatcctccgccttcatt |
20067817 |
T |
 |
| Q |
193 |
agtga |
197 |
Q |
| |
|
||||| |
|
|
| T |
20067818 |
agtga |
20067822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 20067665 - 20067712
Alignment:
| Q |
5 |
actatgggcagtttggaaatttcaaacttaaagcagagggcaattttg |
52 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20067665 |
actatgggcagtttagaaatttcagacttaaagcagagggcaattttg |
20067712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University