View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6416_low_5 (Length: 311)
Name: NF6416_low_5
Description: NF6416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6416_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 33300345 - 33300559
Alignment:
| Q |
17 |
acttactataatcatttcatcaaattatgttgaaagtgtgtgattattcgtcgaaaattataacttctactatttatgtgaaaaatatatcttctattta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33300345 |
acttactataatcatttcatcaaattatgttgaaagtgtgtgattattcgtcgaaaactataccttctactatttatgtgaaaaatatatcttctattta |
33300444 |
T |
|
| Q |
117 |
tgttgtttatcttaatagtatcttaacataac-acaacatcttctgtatctatcataaactcgtgtggtaacttagatatatgccaagtatctataaagt |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33300445 |
tgttgtttattttaatagtatcttaacataacaacaacatcttctgtatctatcataaactcgtgtggtaacttagatatatgccaagtatctataaagt |
33300544 |
T |
|
| Q |
216 |
ttatgatattcaaaa |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33300545 |
ttatgatattcaaaa |
33300559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 95
Target Start/End: Original strand, 33305022 - 33305100
Alignment:
| Q |
17 |
acttactataatcatttcatcaaattatgttgaaagtgtgtgattattcgtcgaaaattataacttctactatttatgt |
95 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| | || ||||||||||| |||| ||||||||||||||| |
|
|
| T |
33305022 |
acttactataatcattccatccaattatgttgaaagtacatagttgttcgtcgaaaaatatatattctactatttatgt |
33305100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University