View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6416_low_7 (Length: 289)
Name: NF6416_low_7
Description: NF6416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6416_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 278
Target Start/End: Original strand, 27328824 - 27329084
Alignment:
| Q |
17 |
ataaatctcctggcctgtgtgacgtttcatcagctgtcacctgttctactatgacaccatcacattatttgcatgccactaaaatagcaccacaaattca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27328824 |
ataaatctcctggcctgtgtgacgtttcatcagctgtcacctgttctactatgacaccatcacattatttgcatgccactaaaatagcaccgcaaattca |
27328923 |
T |
 |
| Q |
117 |
tttggagtttgttgctctaagaaaaaataaatgtattaaattaaagttagctcttgagcatattagtttgannnnnnnnaagaattgggaactagtagtg |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27328924 |
tttggagttggttgctctaagaaaaaataaatgtattatattaaagttagctcttgagcatattagtttgatttttttaaagaattgggaactagtagtg |
27329023 |
T |
 |
| Q |
217 |
ttcattttaaggtacaccatgaaaccnnnnnnnnnnattctttaaaagtgctctaacttcat |
278 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27329024 |
ttcattttaaggtacaccatgaaacc-tttttttttattctttaaaagtgctctaacttcat |
27329084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University