View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6416_low_8 (Length: 258)
Name: NF6416_low_8
Description: NF6416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6416_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 37061692 - 37061451
Alignment:
| Q |
13 |
aatatgatgatctaaggttaaattctagctgaaaattgcatctaaagtttaattagggttgctccggtgccaatttgtgttaactaatttagcttcttnn |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37061692 |
aatatggtgatctaaggttaaattctagttgaaaattgcatctaaactttaattagcgttgctctggtgccaatttgtgttaactaatttagcttcttaa |
37061593 |
T |
|
| Q |
113 |
nnnnnncagtttaattaccgttggaa-gaagtatatgtatttaatatatgactgtgtattgaatatgatttacctttaacaataaagaaaatttatgaaa |
211 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37061592 |
aaaaagaagtttaattactgttgaaaagaagtatatgtatttaatatatgattgtgtattgaatatgatttacctttaacaataaagaaaatttatgaaa |
37061493 |
T |
|
| Q |
212 |
aactgaagaaatggaaattgaactcgtttctatgcacaagtt |
253 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37061492 |
aactgaagaaaaggaaattgaactcgtttctatgcacaagtt |
37061451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University