View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6417_high_7 (Length: 323)
Name: NF6417_high_7
Description: NF6417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6417_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 36 - 312
Target Start/End: Complemental strand, 40651773 - 40651497
Alignment:
| Q |
36 |
cattgaaatcttacctgaaccatcttacgaaactcaattgtacggcttggaccatttgaacataaagaaaaggacacctacatgaatgtccgaattgttc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40651773 |
cattgaaatcttacctgaaccatcttacgaaactcaattgtacggcttggaccatttgaacataaagaaaaggacacctgcatgaatgtccgaattgttc |
40651674 |
T |
 |
| Q |
136 |
gtcaatgtggtacttacaaacttaggccaaataactacagcgaggttgcacagagaggtcattgactttgtatggcaacaagaggagcacttgttaacca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
40651673 |
gtcaatgtggtacttacaaacttaggccaaataactaccgcgaggttgcacagagaggtcattggcattgtatggcaacaagaggagcacttgttaacca |
40651574 |
T |
 |
| Q |
236 |
accaaatctagtattttagaatttgtgtagtaaaagaagtgtaaaaaatgtatgtccagcaggcgctaaaatcaaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40651573 |
accaaatctagtattttagaatttgtgtagtaaaagaagtgtaaaaaatgtatgtccagcagccgctaaaatcaaaa |
40651497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 47 - 93
Target Start/End: Complemental strand, 40666656 - 40666610
Alignment:
| Q |
47 |
tacctgaaccatcttacgaaactcaattgtacggcttggaccatttg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40666656 |
tacctgaaccatcttacgaaactcaattgtacggtttggaccatttg |
40666610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University