View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6417_high_9 (Length: 267)
Name: NF6417_high_9
Description: NF6417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6417_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 814618 - 814515
Alignment:
| Q |
18 |
gttttgtgactttttgactctttttgcgttgaaagttatagaacaacacaataaacaatggcgggaatagctatacttgtagatttatggaggaagaatc |
117 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
814618 |
gttttgtgactctttgactctttttgagttgaaagttagagaacaacacaataaacaatggcgggaatagctatacttgtagatctttggaggaagaatc |
814519 |
T |
 |
| Q |
118 |
ataa |
121 |
Q |
| |
|
|||| |
|
|
| T |
814518 |
ataa |
814515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 45 - 121
Target Start/End: Complemental strand, 33727590 - 33727514
Alignment:
| Q |
45 |
gttgaaagttatagaacaacacaataaacaatggcgggaatagctatacttgtagatttatggaggaagaatcataa |
121 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33727590 |
gttgaaagttaaagaacaacacaagaaacaatggcgggaatagctatacttgtagatctatggaggaagaatcataa |
33727514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University