View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6417_low_11 (Length: 212)
Name: NF6417_low_11
Description: NF6417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6417_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 167
Target Start/End: Complemental strand, 37980125 - 37979978
Alignment:
| Q |
20 |
tctaaatctggttaagagtttattcttgacaaaatgagaaggaaattatgaggttggaaagcgaattccctctcttttgctgtaatgagattactcttgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37980125 |
tctaaatctggttaagagtttattcttgacaaaatgagaaggaaattatgaggttggaaagcgaattccctctcttttgctggaatgagattactcttgc |
37980026 |
T |
 |
| Q |
120 |
tcaatcttccttacctatcattcctgagtatgtgatccaatcaactag |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37980025 |
tcaatcttccttacctatcattcctgagtatgtgatccaatcaactag |
37979978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University