View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6417_low_9 (Length: 267)

Name: NF6417_low_9
Description: NF6417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6417_low_9
NF6417_low_9
[»] chr6 (1 HSPs)
chr6 (18-121)||(814515-814618)
[»] chr4 (1 HSPs)
chr4 (45-121)||(33727514-33727590)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 814618 - 814515
Alignment:
18 gttttgtgactttttgactctttttgcgttgaaagttatagaacaacacaataaacaatggcgggaatagctatacttgtagatttatggaggaagaatc 117  Q
    ||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||    
814618 gttttgtgactctttgactctttttgagttgaaagttagagaacaacacaataaacaatggcgggaatagctatacttgtagatctttggaggaagaatc 814519  T
118 ataa 121  Q
    ||||    
814518 ataa 814515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 45 - 121
Target Start/End: Complemental strand, 33727590 - 33727514
Alignment:
45 gttgaaagttatagaacaacacaataaacaatggcgggaatagctatacttgtagatttatggaggaagaatcataa 121  Q
    ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||    
33727590 gttgaaagttaaagaacaacacaagaaacaatggcgggaatagctatacttgtagatctatggaggaagaatcataa 33727514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University