View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6418_high_7 (Length: 235)
Name: NF6418_high_7
Description: NF6418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6418_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Original strand, 31009848 - 31010050
Alignment:
| Q |
15 |
ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgtttctaatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31009848 |
ttattcttttgaaggaataggaatggttttgcctttggaatcagaagcaaaagataaagataaatttggtggagttttgggtttgggaatgttcctaatt |
31009947 |
T |
|
| Q |
115 |
tttctgttgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatctagggcaaggaatgattactg |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009948 |
tttctattgtatggaggttttgctactttaggttactttgcttttggtgaagcaactcaagggattattactacaaatctagggcaaggaatgattactg |
31010047 |
T |
|
| Q |
215 |
ctt |
217 |
Q |
| |
|
||| |
|
|
| T |
31010048 |
ctt |
31010050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University