View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6419_high_3 (Length: 245)
Name: NF6419_high_3
Description: NF6419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6419_high_3 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 98 - 245
Target Start/End: Complemental strand, 4745058 - 4744911
Alignment:
| Q |
98 |
attgtgaaattcgtataaaaatattatatggtgggataagaagcatgtgcagcaatgccacattgaccccgaggttcaccactttcccttaacactttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |||| |
|
|
| T |
4745058 |
attgtgaaattcgtataaaaatattatatgatgggataagaagcatgtgcagcaatgccacattgacctcctggttcaccactttccctcaacaacttca |
4744959 |
T |
 |
| Q |
198 |
tgtagccttcttcaccccaacctttaccccaagaattcttaatcaacc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4744958 |
tgtagccttcttcaccccaacctttaccccaagaattcttaatcaacc |
4744911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 245
Target Start/End: Complemental strand, 4736523 - 4736400
Alignment:
| Q |
122 |
tatatggtgggataagaagcatgtgcagcaatgccacattgaccccgaggttcaccactttcccttaacactttcatgtagccttcttcaccccaacctt |
221 |
Q |
| |
|
||||| || ||||||| ||||||| ||||||||| ||||||||| | || | ||| ||||||||||| ||| ||||||||||||| |||||||| || |
|
|
| T |
4736523 |
tatatagtaggataagcagcatgtacagcaatgctacattgacctccagttgcactactttcccttagcaccttcatgtagcctttctcaccccatgttt |
4736424 |
T |
 |
| Q |
222 |
taccccaagaattcttaatcaacc |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4736423 |
caccccaagaattcttaatcaacc |
4736400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University