View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6421_high_3 (Length: 239)
Name: NF6421_high_3
Description: NF6421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6421_high_3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 12956412 - 12956637
Alignment:
| Q |
14 |
atcatccaatgcctagtattccttcaccacatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12956412 |
atcatccaatgcctagtattccttcaccgcatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat |
12956511 |
T |
|
| Q |
114 |
gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaatttttcgttctcacccatggcacagtca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
12956512 |
gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaattttccgttctcacccatgggacagtca |
12956611 |
T |
|
| Q |
214 |
ggaattttagggcctggccctcaacc |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12956612 |
ggaattttagggcctggccctcaacc |
12956637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University