View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6421_low_4 (Length: 239)

Name: NF6421_low_4
Description: NF6421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6421_low_4
NF6421_low_4
[»] chr5 (1 HSPs)
chr5 (14-239)||(12956412-12956637)


Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 239
Target Start/End: Original strand, 12956412 - 12956637
Alignment:
14 atcatccaatgcctagtattccttcaccacatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat 113  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12956412 atcatccaatgcctagtattccttcaccgcatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat 12956511  T
114 gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaatttttcgttctcacccatggcacagtca 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||    
12956512 gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaattttccgttctcacccatgggacagtca 12956611  T
214 ggaattttagggcctggccctcaacc 239  Q
    ||||||||||||||||||||||||||    
12956612 ggaattttagggcctggccctcaacc 12956637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University