View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6421_low_6 (Length: 224)
Name: NF6421_low_6
Description: NF6421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6421_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 43764703 - 43764489
Alignment:
| Q |
1 |
ctatgaccaaaatcctacttctaagttctagctaagcaccatacttcaannnnnnnnngcaatgctacattgggaatccaaggccttgatattgaaaact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
43764703 |
ctatgaccaaaatcctacttctaagttctagctaagcaccatacttcaatttttttt-gcaatgctatattgggaatcctaggcctttatattgaaaact |
43764605 |
T |
 |
| Q |
101 |
cctttaggactgtttccacttttaccaatcaaagccactaagaaaatgcaaaattcaatgagctttgaattcgagggattgtaaatttggaaaccaacaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43764604 |
cctttaggaatgtttccacttttaccaatcaaagccactaagaaaatgcaaaattcaatgagctttgaattcgagggattgtaaatttggaaaccaacaa |
43764505 |
T |
 |
| Q |
201 |
tataatggtgatgatg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43764504 |
tataatggtgatgatg |
43764489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University